anti-doping raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2026-04-25. Anything still debated is marked as such rather than presented as settled.
Quality varies among research-grade suppliers, so certificates of analysis and independent testing are important for verification. A typical certificate reports purity by HPLC, identity by mass spectrometry, appearance, and sometimes residual solvents or water content. AOD9604 is often sold as a research chemical not intended for human consumption, and labels can be inaccurate. Common misconceptions include treating the peptide as a form of growth hormone, assuming supplement status, or expecting approved-drug quality from unregulated products.
AOD9604 is commonly supplied as a white to off-white lyophilized powder. The powder is typically stored at -20 °C or below, protected from light and moisture, because peptides can degrade through oxidation, hydrolysis, or aggregation. If it is reconstituted for laboratory use, an appropriate aqueous buffer or solvent is chosen, and the solution is kept cold and handled to avoid repeated freeze-thaw cycles. These practices support stability but do not imply suitability for human use.
In laboratory settings, AOD-9604 is commonly supplied as a lyophilized powder and stored cold to limit degradation. Reconstituted solutions are typically kept refrigerated or frozen, depending on the buffer and concentration, and protected from repeated freeze-thaw cycles. Stability can be influenced by pH, temperature, and the presence of proteases. Purity is usually assessed by high-performance liquid chromatography and mass spectrometry. These practices support reproducibility, but they do not imply safety or efficacy for any human use.
Regulatory status: AOD-9604 is not approved as a therapeutic drug in the United States, European Union, or other major markets. It is listed by the World Anti-Doping Agency as a prohibited substance in sport, specifically under growth hormone fragments. Many jurisdictions restrict its sale for human consumption. Products marketed online may not meet pharmaceutical quality standards. The legal status varies by country and often depends on whether the material is presented as a research chemical, supplement, or drug.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Lyophilized form; visual inspection |
| Solubility | Soluble in water and aqueous buffers | Depends on pH, purity, and counterion |
| Typical storage | -20 °C or below, desiccated | Protect from light; avoid repeated freeze-thaw after reconstitution |
| Common analytical method | Reversed-phase HPLC and mass spectrometry | Purity by HPLC; identity and mass by LC-MS or MALDI-TOF |
| Common synonyms | hGH fragment 176–191; AOD-9604 | Names vary in research and product labeling |
Detection of AOD-9604 in biological samples relies on analytical techniques capable of distinguishing a small synthetic peptide from related endogenous sequences. Liquid chromatography coupled with tandem mass spectrometry is commonly used for confirmatory analysis. Sample preparation may involve immunoaffinity enrichment or solid-phase extraction to concentrate the peptide. Because the molecule is small and may be present at low concentrations, assay sensitivity and specificity are ongoing analytical challenges. Laboratories also validate methods against reference materials when available.
Regulatory interest in AOD-9604 increased after high-profile anti-doping cases involving peptide products. In some cases, the substance was supplied under alternative names or in compounded preparations, complicating traceability. Sports tribunals and anti-doping panels have discussed whether the peptide was explicitly banned at the time of use, leading to clarifications by the World Anti-Doping Agency. For consumers and researchers, the legal status can vary by jurisdiction, and products marketed as research chemicals may lack independent quality verification.
AOD-9604 is listed as a prohibited substance in sport by the World Anti-Doping Agency. It falls under the peptide hormones, growth factors, related substances, and mimetics class on the prohibited list. Anti-doping organizations treat its presence in an athlete's sample as an adverse finding unless a therapeutic use exemption applies. The prohibition reflects concerns about performance enhancement in competitive settings and the difficulty of distinguishing exogenous peptide use from endogenous hormone fragments.
AOD-9604 is prohibited in sport by the World Anti-Doping Agency under the peptide hormone class. Its presence in a sample can be detected through mass spectrometry-based methods, although the exact assay depends on the laboratory. In research settings, material is often supplied as a lyophilized powder for reconstitution. Buyers and researchers should note that products labeled AOD-9604 may vary in purity and actual peptide content. Analytical certificates and independent testing are common ways to verify identity, but no global harmonized standard exists for all commercial lots.
AOD-9604 is a synthetic peptide whose sequence is modeled on the C-terminal region of human growth hormone. Published descriptions commonly place it as a modified fragment corresponding to hGH amino acids 176–191, with a tyrosine residue added or retained at the N-terminus to support detection and handling. It is not intact growth hormone and lacks the full receptor-binding architecture of the parent protein. The molecule was developed as a research candidate for metabolic studies rather than as a replacement for growth hormone therapy. Its identity is defined by its amino acid sequence rather than by any single commercial preparation.
Research interest in AOD-9604 often focuses on whether it can influence lipid metabolism without the growth-promoting or glucose-related effects of full-length hGH. This question remains unresolved, and findings depend on model, dose, and measurement method. Some reviews treat the peptide as a historical obesity candidate rather than an active therapeutic. Others cite it in discussions of peptide fragments, metabolic signaling, and performance-enhancing substances. Clear conclusions are limited by the small number of rigorous, independent human studies.
AOD-9604 has been investigated primarily as a potential treatment for obesity and related metabolic conditions. Early laboratory work examined its effects on fat cells, and later studies moved into animal models and human clinical trials. Some trials reportedly reached Phase II, but the program did not lead to an approved medicine. Published summaries often note that weight-loss results were modest or inconsistent. The full trial data are not all publicly available in detail.
Clinical development of AOD9604 included trials in people with obesity, but the results did not lead to approval as a prescription medicine in major markets. Interest later shifted to research settings and to unapproved products marketed for body composition. Regulatory agencies have questioned whether the peptide qualifies as a dietary ingredient, and some have issued warnings about its presence in supplements. Long-term human safety data are limited, and questions about efficacy, dosing, and target populations remain unresolved.
AOD9604 is a synthetic peptide modeled on the C-terminal region of human growth hormone. It corresponds to a short sequence near the end of the 191-amino-acid hormone, often described as residues 176–191 or a related fragment. Researchers designed it to separate metabolic effects from the growth-promoting actions of full-length growth hormone. Early work in the 1990s explored it as a candidate for weight and lipid disorders. It is not a naturally circulating hormone fragment produced in large amounts.
Laboratory studies have reported that AOD9604 can increase lipolysis and reduce lipid accumulation in fat cells. The precise molecular target remains uncertain, and the compound does not appear to activate the growth hormone receptor in the same way as full-length hGH. Proposed mechanisms include effects on beta-adrenergic signaling and enzymes involved in fatty acid synthesis, but these pathways are not firmly established. Because most evidence comes from cell and animal models, whether the same effects occur in humans is an open question.
==== Minor commercial and recreational uses ==== Helium as a breathing gas has no narcotic properties, so helium mixtures such as trimix, heliox and heliair are used for deep diving to reduce the effects of narcosis, which worsen with increasing depth. As pressure increases with depth, the density of the breathing gas also increases, and the low molecular weight of helium is found to considerably reduce the effort of breathing by lowering the density of the mixture. This reduces the Reynolds number of flow, leading to a reduction of turbulent flow and an increase in laminar flow, which requires less breathing. At depths below 150 metres (490 ft) divers breathing helium-oxygen mixtures begin to experience tremors and a decrease in psychomotor function, symptoms of high-pressure nervous syndrome. This effect may be countered to some extent by adding an amount of narcotic gas such as hydrogen or nitrogen to a helium–oxygen mixture. Helium–neon lasers, a type of low-powered gas laser producing a red beam, had various practical applications which included barcode readers and laser pointers, before they were almost universally replaced by cheaper diode lasers. For its inertness and high thermal conductivity, neutron transparency, and because it does not form radioactive isotopes under reactor conditions, helium is used as a heat-transfer medium in some gas-cooled nuclear reactors. Helium, mixed with a heavier gas such as xenon, is useful for thermoacoustic refrigeration due to the resulting high heat capacity ratio and low Prandtl number.
Genetic studies of Xanthoria parietina have revealed significant differentiation among populations, with genetic variation structured by both geographic distance and substrate type. Populations growing on tree bark show higher genetic diversity than those on rock surfaces, though there is no evidence of restricted gene flow between populations on the same substrate type, even when separated by distances of up to 25 km (16 mi). Despite these genetic differences, no corresponding morphological or chemical variation has been observed. At fine spatial scales, X. parietina exhibits high genetic diversity within local populations, with most genetic variation (up to 90%) occurring within rather than between populations. Studies using IGS and ITS (genetic markers used to assess variation) reveal significant diversity even among closely located individuals. Research from Storfosna island, Norway, suggests long-term local adaptation to bark or rock habitats has led to habitat-specific genetic variants, shaping the overall population structure. While local populations may have limited genetic diversity, populations from different geographic regions show significant genetic differentiation. For example, Antarctic populations of Rusavskia elegans from sites just 5–15 km (3.1–9.3 mi) apart differed by one nucleotide. In contrast, those separated by 660 km (410 mi) showed a 14.2% divergence in their DNA sequences.
== Use in bioengineering == RGD-based peptides have found many applications in biological research and medical devices. Culture plates coated with peptides mimicking ECM proteins' adhesion motifs, which promote prolonged culture of human embryonic stem cells, are on the market. RGD is also a universally used tool in the construction of multifunctional "smart" materials, such as tumor-targeted nanoparticles. Further, RGD is widely used in tissue engineering to promote tissue regeneration.
The coat of arms of Scarborough was adopted when the borough became a city on June 29, 1983. A grant of arms was issued by the Canadian Heraldic Authority on February 1, 1996. The coat of arms had a shield within a laurel wreath. Upon this shield were the following elements, in quarters:
== History == The PUN was founded in 1957 as a political platform to support the presidential candidacy of "Papa Doc" Duvalier in the 1957 general election. In the aftermath of the July 1958 coup attempt, the Tonton Macoute — officially named Volunteers of the National Security (French: Volontaires de la Sécurité Nationale, VSN) — was formed as the paramilitary wing of the PUN. In 1963, other political parties in Haiti were outlawed, making the PUN the single political party of the nation. When "Papa Doc" Duvalier died in 1971, his son "Baby Doc" Duvalier succeeded him as the President of the country and the leader of the party. The party would remain in power until the fall and exile of "Baby Doc" Duvalier in 1986, at the height of the Anti-Duvalier protest movement, after which the party would enter a low profile stage, including the change of its name to National Progressive Party (French: Parti progressiste national, PPN). After the return of "Baby Doc" Duvalier from exile in 2011, the party began a process of reconstitution under its original name from 2014, and started opening departmental offices. Suffering a setback with the death of "Baby Doc" Duvalier in 2014, the party nominated Marc-Arthur Drouillard as its candidate in the 2015 presidential election. Towards that time, the legal representative of the party was Philomène Exe.
Sources: en.wikipedia.org
=== Pathogen response === When a plant recognizes an attacking pathogen, one of the first induced reactions is to rapidly produce superoxide (O−2) or hydrogen peroxide (H2O2) to strengthen the cell wall. This prevents the spread of the pathogen to other parts of the plant, essentially forming a net around the pathogen to restrict movement and reproduction. In the mammalian host, ROS is induced as an antimicrobial defense. To highlight the importance of this defense, individuals with chronic granulomatous disease who have deficiencies in generating ROS, are highly susceptible to infection by a broad range of microbes including Salmonella enterica, Staphylococcus aureus, Serratia marcescens, and Aspergillus spp. Studies on the homeostasis of the Drosophila melanogaster's intestines have shown the production of ROS as a key component of the immune response in the gut of the fly. ROS acts both as a bactericide, damaging the bacterial DNA, RNA and proteins, as well as a signalling molecule that induces repair mechanisms of the epithelium. The uracil released by microorganism triggers the production and activity of DUOX, the ROS-producing enzyme in the intestine. DUOX activity is induced according to the level of uracil in the gut; under basal conditions, it is down-regulated by the protein kinase MkP3. The tight regulation of DUOX avoids excessive production of ROS and facilitates differentiation between benign and damage-inducing microorganisms in the gut. The manner in which ROS defends the host from invading microbe is not fully understood.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
On what would've been Staley's 50th birthday, August 22, 2017, Alice in Chains released a video paying tribute to him, featuring Jerry Cantrell, Ann Wilson, Mike McCready, and Barrett Martin. William DuVall revealed that he was thinking about Staley, his grandmother and the Soundgarden lead vocalist Chris Cornell while writing the Alice in Chains' song "Never Fade", from their 2018 album, Rainier Fog. The album's title track, written by Cantrell, is partly a tribute to Staley and Mike Starr. The Mountain Goats opened their 2026 album Days with "Song for Layne Staley."
Neighbouring countries were aware of the high levels of pollution in the Soviet Union but after the dissolution of the Soviet Union it was discovered that its environmental problems were greater than what the Soviet authorities admitted. The Soviet Union was the world's second-largest producer of harmful emissions. In 1988, total emissions in the Soviet Union were about 79% of those in the United States. But since the Soviet GNP was only 54% of that of the United States, this means that the Soviet Union generated 1.5 times more pollution than the United States per unit of GNP. The Chernobyl disaster in the Ukrainian SSR in 1986 was the first major accident at a civilian nuclear power plant. Unparalleled in the world, it resulted in a large number of radioactive isotopes being released into the atmosphere. Radioactive doses were scattered relatively far. Although long-term effects of the accident were unknown, 4,000 new cases of thyroid cancer which resulted from the accident's contamination were reported at the time of the accident, but this led to a relatively low number of deaths (WHO data, 2005). The disaster contributed to the socio-economic crises that resulted in the collapse of the Soviet Union. Another major radioactive accident that took place in the USSR was the Kyshtym disaster. The Kola Peninsula was one of the places with major problems. Around the industrial cities of Monchegorsk and Norilsk, where nickel, for example, is mined, all forests have been destroyed by contamination, while the northern and other parts of Russia have been affected by emissions.
Sources: en.wikipedia.org
Additionally, PELs lack the inherent amplification capabilities of DELs and rely on current mass spectrometric analysis for decoding. Since peptide decoding requires complex mass spectrometry and computational power, this means that current detection sensitivity limits practical PEL sizes.
Naltrexone is available and most commonly used in the form of an oral tablet (50 mg). Vivitrol, a naltrexone formulation for depot injection containing 380 mg of the medication per vial, is also available. Additionally, naltrexone subcutaneous implants are available. While these are manufactured in Australia, they are not authorized for use within Australia (but only for export). By 2009, naltrexone implants showed superior efficacy in the treatment of heroin dependence when compared to the oral form.
== History == Delafloxacin was known as ABT-492, RX-3341, and WQ-3034 while it was under development. Rib-X Pharmaceuticals acquired delafloxacin from Wakunaga Pharmaceutical in 2006. Rib-X was renamed to Melinta Therapeutics in 2013. It was developed and marketed by Melinta Therapeutics (formerly Rib-X Pharmaceuticals), which subsequently merged with Cempra. Key clinical trials for delafloxacin have been performed by Melinta regarding indications for skin and skin structure infections as well as complicated bacterial infections and uncomplicated gonorrhea. The trial on gonorrhea was terminated before data was released. Delafloxacin was approved by the FDA in June 2017, after it was noninferior to vancomycin plus aztreonam in two trials on 1042 patients with acute bacterial skin and skin structure infection. New Drug Applications (NDA) for delafloxacin (Baxdela) 450 mg tablets and 300 mg injections were approved by the FDA in June 2017. The FDA obligated Melinta to conduct further studies as follows:
=== Contact process === In 1831, British vinegar merchant Peregrine Phillips patented the contact process, which was a far more economical process for producing sulfur trioxide and concentrated sulfuric acid. Today, nearly all of the world's sulfuric acid is produced using this method. In the early to mid 19th century "vitriol" plants existed, among other places, in Prestonpans in Scotland, Shropshire and the Lagan Valley in County Antrim, Northern Ireland, where it was used as a bleach for linen. Early bleaching of linen was done using lactic acid from sour milk, but this was a slow process; the use of vitriol sped up the bleaching process.
Algae are used as foods in many countries: China consumes more than 70 species, including fat choy, a cyanobacterium considered a vegetable; Japan, over 20 species such as nori and aonori; Ireland, dulse; Chile, cochayuyo. Laver is used to make laverbread in Wales, where it is known as bara lawr. In Korea, green laver is used to make gim. Some of the most commonly used microalgae as food are:
Sources: en.wikipedia.org
Lyophilized AOD9604 is generally kept at -20 °C or colder, desiccated, and protected from light. Reconstituted solutions are usually refrigerated and handled to minimize repeated freeze-thaw cycles. These are general laboratory handling practices, not instructions for human use.
Mass spectrometry, such as LC-MS or MALDI-TOF, confirms the molecular mass and can reveal sequence-related impurities. Reversed-phase HPLC is used for purity, and peptide mapping or amino acid analysis can support sequence identity. No single method establishes every quality attribute.
No. AOD9604 is a short synthetic fragment of the hGH sequence, not the full 191-amino-acid hormone. It lacks the regions that mediate hGH receptor activation and growth-promoting effects. Products labeled as AOD9604 should not be assumed to have the same properties as hGH.
No major regulatory agency has approved AOD-9604 as a medicine. It is treated as an experimental peptide in research settings. Some countries restrict its sale or import.