hGH fragment is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2025-12-02. Numbers and descriptions here follow the published literature rather than marketing material.
In laboratory settings, AOD-9604 is commonly supplied as a lyophilized powder and stored cold to limit degradation. Reconstituted solutions are typically kept refrigerated or frozen, depending on the buffer and concentration, and protected from repeated freeze-thaw cycles. Stability can be influenced by pH, temperature, and the presence of proteases. Purity is usually assessed by high-performance liquid chromatography and mass spectrometry. These practices support reproducibility, but they do not imply safety or efficacy for any human use.
Regulatory status: AOD-9604 is not approved as a therapeutic drug in the United States, European Union, or other major markets. It is listed by the World Anti-Doping Agency as a prohibited substance in sport, specifically under growth hormone fragments. Many jurisdictions restrict its sale for human consumption. Products marketed online may not meet pharmaceutical quality standards. The legal status varies by country and often depends on whether the material is presented as a research chemical, supplement, or drug.
The peptide is frequently described as a growth hormone fragment, although it is chemically distinct from full-length hGH. AOD-9604 contains 16 amino acids and includes two cysteine residues that can form an intramolecular disulfide bond. In solution, this structural feature can influence folding, aggregation, and stability. Published descriptions sometimes call it hGH 176-191 or AOD9604, with spacing and capitalization varying. Such naming differences can complicate literature searches, database entries, and product verification.
Researchers have studied the fragment in cell and animal models to understand its metabolic actions. Some experiments report effects on fat breakdown and fat storage pathways, but the underlying mechanism remains incompletely defined. AOD-9604 does not appear to stimulate the same broad growth hormone receptor signaling as full-length hGH. Whether its observed activities arise from direct receptor interactions or downstream metabolic changes is an open question. Results from different assays are not always consistent.
AOD-9604 is a synthetic peptide modeled on the C-terminal region of human growth hormone. It corresponds to residues 176-191 of the 191-amino-acid hGH sequence. The fragment is not the full hormone and lacks the receptor-binding region associated with growth and metabolic effects of hGH. Researchers developed it to isolate a specific portion of hGH for study. Its exact sequence and length are often stated in peptide catalogs and patents.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Not approved as a medicine | Status varies by country; prohibited in sport. |
| Common storage temperature | 2–8 °C for lyophilized powder | Protect from light and moisture; follow supplier instructions. |
| Typical analytical method | LC-MS/MS | Used for identification and quantification in biological samples. |
| Purity assessment | HPLC and mass spectrometry | Reverse-phase HPLC is common for peptide purity. |
| Common synonyms | AOD9604; hGH 176-191 fragment | Naming conventions differ across studies. |
In Canada, naloxone single-use syringe kits are distributed and available at various clinics and emergency rooms. Alberta Health Services is increasing the distribution points for naloxone kits at all emergency rooms, and various pharmacies and clinics province-wide. All Edmonton Police Service and Calgary Police Service patrol cars carry an emergency single-use naloxone syringe kit. Some Royal Canadian Mounted Police patrol vehicles also carry the drug, occasionally in excess to help distribute naloxone among users and concerned family/friends. Nurses, paramedics, medical technicians, and emergency medical responders can also prescribe and distribute the drug. As of February 2016, pharmacies across Alberta and some other Canadian jurisdictions are allowed to distribute single-use take-home naloxone kits or prescribe the drug to people using opioids. Following Alberta Health Services, Health Canada reviewed the prescription-only status of naloxone, resulting in plans to remove it in 2016, making naloxone more accessible. Due to the rising number of drug deaths across the country, Health Canada proposed a change to make naloxone more widely available to Canadians in support of efforts to address the growing number of opioid overdoses. In March 2016, Health Canada did change the prescription status of naloxone, as "pharmacies are now able to proactively give out naloxone to those who might experience or witness an opioid overdose."
The wildlife of Brazil comprises all naturally occurring animals, plants, and fungi in the South American country. Home to 60% of the Amazon rainforest, which accounts for approximately one-tenth of all species in the world, Brazil is considered to have the greatest biodiversity of any country on the planet, containing over 70% of all animal and plant species catalogued. Brazil has the most known species of plants (55,000), freshwater fish (3,000) and mammals (over 689). It also ranks third on the list of countries with the most bird species (1,832) and second with the most reptile species (744). The number of fungal species is unknown but is large. Brazil is second only to Indonesia as the country with the most endemic species. Brazil's large territory comprises different ecosystems, such as the Amazon rainforest, recognized as having the greatest biological diversity in the world, with the Atlantic Forest and the Cerrado sustaining the greatest biodiversity. In the south, the Araucaria moist forests grow under temperate conditions. The rich wildlife of Brazil reflects the variety of natural habitats. Scientists estimate that the total number of plant and animal species in Brazil could approach four million, mostly invertebrates. Larger mammals include carnivores pumas, jaguars, ocelots, rare bush dogs, and South American foxes, and herbivores peccaries, tapirs, anteaters, sloths, opossums and armadillos. Deer are plentiful in the south, and many species of New World monkeys are found in the northern rainforests.
All high schools in Prince George's County operate with a "comprehensive" model as their base, with the exception of the Academy of Health Sciences at Prince George's Community College, which is a middle college program. All students are assigned to a high school based on an attendance area. Magnet Programs operate as a "School-Within-A-School" model, where the magnet serves as an alternative program---in addition to the main comprehensive program---and students from outside the regular attendance area of the high school are enrolled and accepted into the magnet, either through continuity (automatic continuation from a middle school magnet program to the high school level equivalent) or more commonly, through a Magnet Lottery, in which students apply for a magnet program and are granted acceptance through a random drawing. Enrollment into the Center for the Visual and Performing Arts is through audition only. Several high schools have also implemented a Smaller Learning Community model, where they offer anywhere from two or more Academy Programs, which effectively breaks a school down into several smaller schools within the school, by allowing students to essentially declare a major (such as a student attending a college or university) through career academies such as "Arts, Media, and Communication" or the "National Academy of Finance," for example. All high schools within PGCPS operate on a staggered school day schedule, where some high schools start as early as 7:45am and end as early as 2:25pm, and other high schools start as late as 9:30am and end as late as 4:10pm.
Sanders' Original Recipe of "11 herbs and spices" is one of the best known trade secrets in the catering industry. The recipe is not patented, because patent law requires public disclosure of an invention and provides protection only for a strictly limited term, whereas trade secrets can remain the intellectual property of their holders in perpetuity. A copy of the recipe, signed by Sanders, is held inside a safe inside a vault in KFC's Louisville headquarters, along with 11 vials containing the herbs and spices. To maintain the secrecy of the recipe, half of it is produced by Griffith Laboratories before it is given to McCormick, who add the second half. In 1999, a couple who bought the house formerly occupied by Colonel Sanders found scribbled notes purported to be the secret recipe. Initially, KFC wanted to file a lawsuit against the couple to stop an auction of the notes but, by early 2001, it dropped the lawsuit, claiming the scribbled notes are "nowhere close" to the original recipe. Joe Ledington of Kentucky, a nephew by marriage of Colonel Sanders, claimed to have found a copy of the original KFC fried chicken recipe on a handwritten piece of paper in an envelope in a scrapbook. In August 2016, Chicago Tribune staffers conducted a cooking test of this recipe and claimed after a few attempts that, with the addition of the MSG flavor-enhancer Ac'cent, they produced fried chicken which tasted "indistinguishable" from the chicken they purchased at KFC.
Sources: en.wikipedia.org
=== Human health === The effect of rBGH on human health is an ongoing debate, in part due to the lack of conclusive evidence. A few of the most debated issues include: Insulin-like growth factor 1 (IGF-1) is a hormone found in humans that is responsible for growth promotion, protein synthesis, and insulin actions over the lifecycle. The hormone has been shown to influence the growth of tumors in some studies and may be linked to the development of prostate, colorectal, breast, and other cancers. IGF-1 is also found in milk. Previous research has proposed an increase of IGF-1 in rBST-treated cows, but this claim is currently not substantiated. In addition, no current evidence shows that orally consumed IGF-1 is absorbed in humans and the dietary amount is negligible when compared to what the body produces on its own. "IGF-1 in milk is not denatured (inactivated) by pasteurization. The extent to which intact, active IGF-1 is absorbed through the human digestive tract remains uncertain." The American Cancer Society has reviewed the evidence concerning IGF-1 in milk from rBST-treated cows, and found that: "While there may be a link between IGF-1 blood levels and cancer, the exact nature of this link remains unclear. Some studies have shown that adults who drink milk have about 10% higher levels of IGF-1 in their blood than those who drink little or no milk. But this same finding has also been reported in people who drink soy milk.
Melanie Ann Stansbury (born January 31, 1979) is an American politician and former ecology instructor serving as the U.S. representative for New Mexico's 1st congressional district since 2021. The district includes the majority of Albuquerque and most of its suburbs. A Democrat, Stansbury previously served as a member of the New Mexico House of Representatives for the 28th district from 2019 to 2021.
The pathway of wing expansion is regulated by a signal-receptor pathway, where the neurohormone bursicon interacts with its complementary G protein-coupled receptor; this receptor drives one of the G-protein subunits to signal further enzyme activity and results in development in the wing, such as apoptosis and growth. se: sepia – The eye color of the sepia mutant is sepia, a reddish-brown color. In wild-type flies, ommochromes (brown) and drosopterins (red) give the eyes the typical red color. The drosopterins are made via a pathway that involves a pyrimidodiazepine synthase, which is encoded on chromosome 3L. The gene has a premature stop codon in sepia flies, so that the flies cannot produce the pyrimidodiazepine synthase and thus no red pigment, so that the eyes stay sepia. The sepia allele is recessive and thus offspring from sepia flies and homozygous wild type flies, has red eyes. The sepia phenotype does not depend on the sex of the fly. v: vermilion – The vermilion mutants cannot produce the brown ommochromes leaving the red drosopterins so that the eyes are vermilion colored (a radiant red) compared to a wild-type D. melanogaster. The vermilion mutation is sex-linked and recessive. The gene that is defective lies on the X chromosome. The brown ommochromes are synthesised from kynurenine, which is made from tryptophane. Vermilion flies cannot convert tryptophane into kynurenine and thus cannot make ommochromes, either. Vermilion mutants live longer than wild-type flies.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
== Pharmacology == Setmelanotide binds to and activates MC4 receptors in the paraventricular nucleus (PVN) of the hypothalamus and in the lateral hypothalamic area (LHA), areas involved in the regulation of appetite, and this action is thought to underlie its appetite suppressant effects. In addition to reducing appetite, setmelanotide increases resting energy expenditure in both obese animals and humans. Importantly, unlike certain other MC4 receptor agonists, such as LY-2112688, setmelanotide has not been found to produce increases in heart rate or blood pressure. Setmelanotide has been reported to possess the following activity profile (cAMP, EC50): MC4 (0.27 nM) > MC3 (5.3 nM) ≈ MC1 (5.8 nM) > MC5 (1600 nM) ≟ MC2 (>1000 nM). (19.6-fold selectivity for MC4 over MC3, the second target of highest activity.)
In this process, a ligand is immobilized on the dextran surface of the SPR crystal. Through a microflow system, a solution with the analyte is injected over the ligand-covered surface. The binding of the analyte to the ligand causes an increase in the SPR signal (expressed in response units, RU). Following the association time, a solution without the analyte (typically a buffer) is introduced into the microfluidics to initiate the dissociation of the bound complex between the ligand and analyte. As the analyte dissociates from the ligand, the SPR signal decreases. From these association ('on rate', ka) and dissociation rates ('off rate', kd), the equilibrium dissociation constant ('binding constant', KD) can be calculated. The detected SPR signal is a consequence of the electromagnetic 'coupling' of the incident light with the surface plasmon of the gold layer. This interaction is particularly sensitive to the characteristics of the layer at the gold–solution interface, which is usually just a few nanometers thick. When substances bind to the surface, it alters the way light is reflected, causing a change in the reflection angle, which can be measured as a signal in SPR experiments. One common application is measuring the kinetics of antibody-antigen interactions.
==== French Polynesia ==== In French Polynesia, glass noodles are known as vermicelle de soja and were introduced to the islands by Hakka agricultural workers during the 19th century. They are most often used in maʻa tinito, a dish made with glass noodles mixed together with pork, beans, and cooked vegetables.
Sources: en.wikipedia.org
No major regulatory agency has approved AOD-9604 as a medicine. It is treated as an experimental peptide in research settings. Some countries restrict its sale or import.
The World Anti-Doping Agency classifies growth hormone fragments, including AOD-9604, as prohibited substances. The classification reflects concern about potential performance-enhancing use. Athletes are subject to testing for such peptides.
Detection typically uses liquid chromatography combined with mass spectrometry. These methods separate the peptide and identify it by mass. Immunoassays may screen samples but require confirmation by a more specific technique.
No, it is a synthetic peptide fragment corresponding to a small portion of hGH. It is not the full 191-amino-acid hormone and does not reproduce all of hGH's effects.